SciELO - Scientific Electronic Library Online

 
vol.15 número1Optimización del protocolo de propagación del plátano cv. CEMSA ¾ en Biorreactores de Inmersión TemporalControl de la autopolinización, germinación del polen y crecimiento del tubo polínico en mandarina "Montenegrina" índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Artigo

Links relacionados

Bookmark

Agrociencia Uruguay

versão impressa ISSN 1510-0839

Agrociencia Uruguay vol.15 no.1 Montevideo jun. 2011

 

Selección de cepas de Herbaspirillum spp. promotoras del crecimiento de arroz



Punschke Karina1, Mayans María1


1Lage y Cía S. A. Camino Carrasco 6948. CP 11700. Montevideo, Uruguay.

Correo electrónico: punschk@adinet.com.uy

Las dos autoras contribuyeron de igual forma en el artículo.



Recibido: 21/6/10 Aceptado: 15/10/10



Resumen


Las bacterias del género Herbaspirillum spp. endófitas promueven el crecimiento vegetal, fijan nitrógeno y producen fitohormonas. La combinación de estos mecanismos puede contribuir a mejorar la eficiencia del uso de fertilizantes nitrogenados en cultivos de importancia agrícola. El objetivo del presente trabajo fue seleccionar cepas de la bacteria diazotrófica Herbaspirillum spp. para promover el crecimiento en plantas de arroz. Se aislaron 113 endófitos diazotróficos de la parte aérea de plantas de arroz de diferentes variedades y estadios fenológicos. Once fueron identificados como presuntos Herbaspirillum spp. según sus características morfológicas y fisiológicas. De éstos, dos aislamientos (9.4 y 4.2) produjeron aumentos significativos en la biomasa aérea de plantas de arroz crecidas en condiciones controladas. Ambos aislamientos se ensayaron en plantas cultivadas en invernáculo en ausencia y presencia de urea. La biomasa radicular de las plantas inoculadas con el aislamiento 4.2 fue significativamente mayor tanto en presencia como en ausencia del 50% de la dosis de urea utilizada por los productores (100 kg/ha). Se evaluó el efecto de la inoculación de semillas de arroz con el aislamiento 4.2 en campo. Se incluyeron tratamientos inoculados y sin inocular con diferentes dosis de fertilización nitrogenada. Se obtuvo una mejora del 15% en el rendimiento de los cultivos inoculados respecto a los testigos sin inocular. La secuenciación del gen 16S ARNr indicó que la cepa 4.2 pertenece al género Herbaspirillum spp. Se concluye que la cepa 4.2 de Herbaspirillum spp. posee potencial como biofertilizante en arroz, maximizando el aprovechamiento de los recursos.


Palabras clave: ASOCIACIÓN BACTERIA-PLANTA, ENDÓFITO, INOCULACIÓN



Summary


Strain selection of growth promoting Herbaspirillum spp. in rice


Endophytic bacteria of the genus Herbaspirillum spp. are able to fix nitrogen and produce plant growth promoting compounds. The combination of these mechanisms can contribute to optimizing the efficiency of nitrogen fertilizers in crops of agricultural importance The aim of this work was to select strains of diazotrophic bacteria Herbaspirillum spp. to promote growth in rice plants. 113 diazotrophs were isolated from aerial tissue of different varieties and phenological stages. Eleven isolates were characterized as presumptive Herbaspirillum spp. Of these, two isolates obtained from the vegetative stage (9.4 and 4.2) produced significant increases in shoot dry matter under controlled conditions. Both isolates were tested in rice plants grown in greenhouse in the absence and presence of urea. The root biomass of plants inoculated with isolate 4.2 was significantly higher both in the presence and absence of 50% of the dose of urea used by farmers (100 kg/ha). Plant growth-promoting effect of strain 4.2 was reflected in plant yield. Inoculated and non inoculated treatments were carried out with differentdoses of nitrogen fertilization in field conditions. A 15% increase in plant yield was obtained for inoculated plants in comparison with non inoculated. The 16S rRNA gene sequence indicated that 4.2 strain belongs to the genus Herbaspirillum spp. Therefore, we conclude that Herbaspirillum spp. 4.2 strain has potential as biofertilizer in rice, maximizing the efficiency in the use of resources and sustainability.


Key words: bacteria-plant association, endophyte, inoculation


Introducción


En los últimos años, debido al impacto negativo de la agricultura en el ambiente y a los altos costos de producción ha surgido el concepto de agricultura sostenible, definida como la manera de cultivar el suelo conservando al máximo la calidad medioambiental. Una opción es el uso de biofertilizantes para disminuir la aplicación de fertilizantes químicos (Bonilla et al., 2000). Tradicionalmente se han usado bacterias del suelo en la producción de inoculantes para aumentar el rendimiento de los cultivos (Burris, 1988), siendo los rizobios los primeros microorganismos fijadores de nitrógeno (N) utilizados en la agricultura. En los últimos años se han demostrado los efectos benéficos de bacterias endófitas obligadas asociadas a gramíneas de interés económico (App et al., 1984). Dentro de este grupo se destaca Herbaspirillum spp., capaz de asociarse endofíticamente con una amplia gama de plantas, incluyendo arroz y caña de azúcar. La especie H. seropedicae ha recibido especial atención dado que algunas cepas son capaces de promover el crecimiento vegetal en determinadas variedades de arroz (Baldani et al.; 2000; Elbeltagy et al., 2001). Estas bacterias son consideradas promotoras del crecimiento vegetal, fijadoras de nitrógeno y productoras de hormonas estimulantes del crecimiento de la planta, como ácido indol acético y giberelinas (Figueiredo et al., 2008). Respecto a la producción de fitohormonas, los efectos generales que producen en la planta pueden ser directos, a través de la promoción del crecimiento, o indirectos mejorando la nutrición de las plantas por un mayor desarrollo radicular (Fuentes et al., 2006). El efecto observado es el aumento del tamaño y la densidad de los pelos radiculares, desencadenando una mejora en la capacidad de absorber agua y nutrientes minerales en un volumen mayor de suelo (Fuentes, et al., 2006). En las relaciones endofiticas, las bacterias residen dentro de los espacios intercelulares o en el interior de las células de la planta huésped. Las bacterias en estos sitios endofíticos acceden a los nutrientes y al agua más fácilmente que en la superficie. Además pueden obtener protección frente a las fluctuaciones del medio ambiente y ventajas frente a la intensa competencia por los nutrientes característicos de la rizósfera (Baldani et al., 1997). La entrada bacteriana en las plantas ocurre en los sitios de daño epidérmico, de raíz lateral o aparición radicular, a través de aberturas naturales como estomas. La concentración de estas bacterias en los tejidos de la planta, el grado de colonización y su eficiencia están relacionados con: el genotipo de la planta, el tejido vegetal, el estadio fenológico del cultivo, el desarrollo radical, el flujo de fotosintatos hacia la raíz y el marco agronómico, fundamentalmente en lo que refiere a variedades, condiciones de siembra y uso de fertilizantes (Barraquio et al., 1997). En Uruguay el arroz se cultiva generalmente en rotación con leguminosas forrajeras, lo que brinda un aporte de N (nitrógeno) proveniente de la fijación biológica de nitrógeno (FBN) que queda en el suelo para el siguiente cultivo. Sin embargo es común el uso de fertilizantes nitrogenados, ya que el N proveniente de la FBN de la pastura que lo antecede no es suficiente para lograr el máximo rendimiento del cultivo. El objetivo de esta investigación es seleccionar cepas de bacterias diazotróficas endofíticas (Herbaspirillum spp.) promotoras del crecimiento en plantas en arroz, contribuyendo así a la sostenibilidad del cultivo, aumentando la eficiencia en el uso de fertilizantes nitrogenados.


Materiales y métodos


Cuantificación, aislamiento y caracterización de bacterias diazotróficas endofíticas


Se muestrearon 20 plantas de arroz de cada una de las nueve chacras comerciales ubicadas en la zona de Vergara en el departamento de Treinta y Tres. Las variedades muestreadas fueron INIA Olimar, Coronilla y El Paso 144, tanto en el estadio vegetativo como en el inicio de floración (Cuadro 1). Los aislamientos de bacterias endófitas fijadoras de N se realizaron a partir de la parte aérea de la planta (hoja y tallo). Para cuantificar y aislar bacterias endófitas diazotróficas, se desinfectó con etanol 70% la superficie de 1 g de tejido vegetal durante 30 segundos. Las muestras se maceraron con 9 ml de agua estéril en mortero, a partir de esta suspensión se realizaron diluciones seriadas. Se inocularon frascos conteniendo medio de cultivo JNFb semisólido, semi-específico para Herbaspirillum spp. (Dobereiner et al., 1995). Los cultivos se incubaron a 35 °C de cuatro a siete días y se evaluó la formación de velo sub superficial. El recuento de la población bacteriana se determinó por la técnica de número más probable (NMP) utilizando la tabla de McCrady para tres repeticiones (Dobereiner et al., 1995). Para proceder al aislamiento se retiraron con anza las películas de aquellos frascos de mayor dilución y se transfirieron a un nuevo medio semi-sólido. Luego de 10 días las películas se transfirieron a placas de Petri con medio JNFb sólido enriquecido con 20 mg/l de extracto de levadura. Para la purificación final las películas se transfirieron a placas de Petri conteniendo medio Batata (Dobereiner et al., 1995). Este proceso se repitió hasta la obtención de colonias puras con las características morfológicas típicas de Herbaspirillum spp. (Dobereiner et al., 1995; Baldani et al., 2000; Estrada de Los Santos et al., 2001). Los aislamientos obtenidos se observaron en microscopio óptico para su caracterización morfológica y motilidad celular de acuerdo con los datos descritos para este género en el Bergey´s Manual (2005). Aquellos aislamientos que mostraron la morfología característica de Herbaspirillum spp. se conservaron a -20 °C en glicerol 50%.


Selección inicial de bacterias promotoras del crecimiento en plantas de arroz en condiciones controladas


Semillas de arroz de la variedad El Paso 144 se descascararon y desinfectaron en superficie con etanol 70% durante 30 segundos, cloramina T 1% durante cuatro minutos, y ocho lavados posteriores con agua estéril, dejándolas embeber en el último lavado por 30 minutos (Carcaño-Montiel et al., 2006). Las semillas se pregerminaron en placas con agar 0,8% en agua en oscuridad a 28 °C durante 48 horas. Se evaluaron once aislamientos de presuntos Herbaspirillum spp. utilizando tubos para planta con 40 ml de medio Hoagland (Hoagland y Arnon, 1950) sin N y con 0,6% de agar, empleándose cinco repeticiones por tratamiento. La inoculación con las bacterias crecidas en medio líquido JNFb enriquecido con 1g/l de NH4Cl, se realizó antes de la solidificación del agar. Se sembró 1 ml de caldo en fase exponencial de crecimiento (108 cel/ml) por tubo. Se agregó 1 ml de medio estéril al tratamiento control T (sin inocular y sin N). Se sembró una semilla pregerminada por tubo. Se incubó durante 30 días en cámara de crecimiento con condiciones controladas de temperatura (25-30 °C), y luz (tubo Silvanya Grolux), con un fotoperíodo de 12 horas luz/12 horas oscuridad, de acuerdo con Baldani, et al. (2000). Se regó periódicamente con solución Hoagland libre de N (diluida al ¼) estéril. Se determinó la producción de biomasa aérea y radicular secando el material vegetal en estufa (60 ºC) hasta peso constante. El análisis de varianza se realizó por ANOVA-1 para determinar si existían diferencias entre las medias de los tratamientos. Se utilizó un test DGC de comparación de medias, para establecer cuáles tratamientos se diferenciaban significativamente. Para el análisis estadístico de esta respuesta fenotípica se utilizó el programa InfoStat (versión 2008).


Promoción del crecimiento de plantas de arroz en invernáculo


Se seleccionaron los aislamientos que resultaron más promisorios en la etapa anterior. Se desinfectaron superficialmente semillas de arroz de la variedad El Paso 144 según lo descrito anteriormente. Se utilizaron macetas conteniendo tres kg de suelo (P-P2O5 7,3 ppm, N-NO3 10,5 ppm), empleándose cinco repeticiones por tratamiento. Se sembraron diez semillas de arroz previamente inoculadas con cultivos líquidos en fase exponencial (108 cel/ml) de las cepas a evaluar utilizando una dosis de 1200 ml para 100 kg de semilla. Se evaluó el efecto de la inoculación de plantas crecidas en ausencia de N agregado y con el agregado de 50% de la dosis de N utilizada habitualmente por los productores no limitante (100 kg/ha de urea). Se incluyeron un testigo sin inocular y sin N (T) y un testigo sin inocular y con N agregado (N). Se regó periódicamente a capacidad de campo con agua desionizada durante 45 días. Se determinó la producción de biomasa aérea y radicular secando el material vegetal en estufa (60 °C) hasta peso constante. El análisis de varianza se realizó por ANOVA-1 para determinar si existían diferencias entre las medias de los tratamientos. Se utilizó un test DGC de comparación de medias, para establecer cuales tratamientos se diferenciaban significativamente. Para el análisis estadístico de esta respuesta fenotípica se utilizó el programa InfoStat (versión 2008).


Respuesta del arroz a la inoculación en campo


Durante la zafra 2008-2009 se evaluó en el campo el efecto de la inoculación de las semillas de arroz con la cepa más promisoria seleccionada anteriormente. El ensayo fue instalado por la consultora AS.IN.AGRO., en la localidad de Vergara en el departamento de Treinta y Tres, zona representativa de la cuenca tradicional arrocera de la Laguna Merín sobre un suelo Planosol Subéutrico Ocrico de costas del arroyo Parao. (pH en H2O: 5,41; M.O.: 3%;P- P2O5: 6 ppm; K- K2O:0,31 meq; Zn: 0,8 ppm). Se utilizó un diseño de parcelas divididas con parcelas menores al azar con tres repeticiones. Las parcelas mayores correspondieron a los tratamientos con y sin inoculación, y las parcelas menores a los diferentes niveles de fertilización nitrogenada. Se sembró la variedad El Paso 144 con una densidad de siembra de 140 kg/ha. Al momento de la siembra todas las parcelas se fertilizaron con 130 kg/ha de fosfato de amonio. Previo a la siembra, se inoculó la semilla en un recipiente con una suspensión celular (108cel/ml) a razón de 1200 ml cada 100 kg de semilla de arroz, sin el agregado de agua u otro producto adicional. Se manejaron diferentes niveles de fertilización en cobertura utilizando urea como fuente nitrogenada. Se incluyeron tratamientos inoculados y sin inocular en ambos casos con tres niveles de fertilización nitrogenada (0, 60 y 100 kg/ha de urea). Se evaluaron cantidades de urea utilizadas habitualmente por los productores, suministrando un 50% del total al momento del macollaje y el resto previo a la formación del primordio floral. Se evaluó el rendimiento en grano corregido considerando un 14% de humedad. El análisis de varianza se realizó por ANOVA-1 para determinar si existían diferencias entre las medias de los tratamientos. Se utilizó el test de Tukey al nivel del 5% para comparación de medias. Para el análisis estadístico de esta respuesta fenotípica se utilizó el programa InfoStat (versión 2008).


Secuenciación del gen 16S ARNr y estudio filogenético


A partir del aislamiento más promisorio seleccionado de los ensayos anteriores se realizó la extracción de ADN utilizando el kit AXYGEN (DNA Extraction kit). Se obtuvo ADN en cantidad y calidad suficiente para la amplificación por PCR de un fragmento de aproximadamente 1500 bases utilizando cebadores consenso del gen 16S ARNr. El fragmento fue purificado y enviado a secuenciar con cebadores específicos 27F (5´AGAGTTTGATCMTGGCTC ´3) y 16SR (5´ATACTAGCGACTCCGACTTC ´3) al Servicio de Secuenciación del Institut Pasteur de Montevideo. Las secuencias obtenidas fueron comparadas con las depositadas en el GenBank utilizando la herramienta BLAST (www.ncbi.nlm.nih.gov/blast) y en la base de datos Ribosomal Database Project (http://rdp.cme.msu.edu/).


Resultados


Aislamientos obtenidos y caracterización morfofisiológica


Los recuentos de bacterias diazotróficas endófitas estuvieron en el orden de 103 a 106 células/g de tejido (datos no mostrados). Se obtuvieron 113 aislamientos capaces de formar velo sub-superficial en medio JNFb semisólido sin nitrógeno, de los cuales once se clasificaron como presuntos Herbaspirillum spp. De éstos, siete se aislaron de la variedad INIA Olimar y cuatro de la variedad Coronilla. No se obtuvieron aislamientos con características semejantes a Herbaspirillum spp. en la variedad El Paso 144 (Cuaro 1). La caracterización morfológica de los aislamientos de presuntos Herbaspirillum spp. reveló células vibroides (bacilos curvados) y móviles. El crecimiento en medio de cultivo JNFb sólido mostró la presencia de colonias pequeñas de tipo circular, con centro azul oscuro por acúmulo del indicador. En placas con medio Batata se observaron colonias húmedas y pequeñas con centro marrón, semejante a lo descrito por Baldani, et al. (1986,1996).


Selección inicial de bacterias promotoras del crecimiento en plantas de arroz en condiciones controladas


Se evaluaron once aislamientos seleccionados en la etapa anterior, siendo seis obtenidos a partir de plantas en estadio vegetativo y cinco de plantas en estadio de floración. En el Cuadro 2 se muestra la producción de materia seca de la parte aérea y radicular de plantas de arroz inoculadas con los aislamientos en ausencia de nitrógeno luego de 30 días de incubación.

El peso promedio de la materia seca de la parte aérea de las plantas inoculadas varió entre 27 y 54 mg/planta. Los valores promedio obtenidos correspondientes a la biomasa radicular variaron entre 12 y 21 mg/planta. Se observa que los aislamientos 9.4 y 4.2 promovieron significativamente la biomasa de la parte aérea (un 89% y 68% respectivamente) en relación al testigo T. Ambos aislamientos provienen de la variedad INIA Olimar y se obtuvieron de plantas en estadio vegetativo. Si bien se observó una mejora en la producción de materia seca aérea debido a la inoculación con nueve de los aislamientos, las diferencias obtenidas no fueron significativas. No hubo efecto de la inoculación sobre la producción de materia seca de la parte radicular.


Evaluación de promoción del crecimiento de plantas de arroz en invernáculo con cepas seleccionadas de presuntos Herbaspirullum spp.


Los aislamientos más promisorios de la etapa anterior (4.2 y 9.4) se evaluaron en condiciones de invernáculo. Al comparar el tratamiento inoculado con la cepa 4.2 respecto al tratamiento T se observó que las plantas inoculadas con esta cepa presentaban una biomasa radicular significativamente mayor tanto en presencia como en ausencia de N agregado (Figura 1). Este efecto también se observó al comparar el tratamiento inoculado con la cepa 9.4 respecto al testigo T sólo en presencia de N agregado (Figura 2). Los beneficios causados por estos aislamientos pueden deberse a la producción de fitohormonas y no solamente a la FBN. No se obtuvieron diferencias significativas en los valores de materia seca de la parte aérea entre los aislamientos utilizados y el testigo (datos no mostrados).



Respuesta del arroz a la inoculación en campo


Según los resultados obtenidos en el análisis de varianza, se observó que el factor principal de la determinación del rendimiento correspondió a la inoculación con la cepa 4.2 (p=0.0261), no detectándose diferencias significativas debidas a la fertilización nitrogenada (p=0.2590) ni a la interacción de ambos factores (p=0.9704).


Los valores de rendimiento en grano promedio (kg/ha) de los tratamientos inoculados con la cepa 4.2 fueron significativamente mayores que los promedios de los tratamientos sin inocular para los tres niveles de nitrógeno evaluados (Cuadro 3). Para el promedio de todos los niveles de fertilización, el aumento de rendimiento en respuesta a la inoculación fue de 15%, lo que significa un incremento de 34 bolsas de 50 kg de grano cosechado por hectárea.


El tratamiento inoculado con la cepa 4.2 y con 100 kg/ha de urea fraccionada en dos coberturas, alcanzó la máxima productividad del ensayo (12391 kg/ha), mientras que el rendimiento del tratamiento con la misma dosis de fertilización pero sin inocular fue de 10711 kg/ha.


Por lo anterior, si bien existe un efecto promotor de la inoculación con la cepa 4.2 independiente de la fertilización en el rendimiento en grano, dicho efecto se expresó en mayor magnitud cuando la inoculación estuvo acompañada de la máxima dosis de fertilización nitrogenada. Las ventajas de la inoculación podrían estar asociadas a una mayor eficiencia en el uso del agua, nitrógeno y otros nutrientes, además de la FBN. A partir de estos resultados se destaca el impacto de la inoculación con la cepa 4.2 en la producción de arroz, en todos los niveles de nitrógeno.


Secuenciación del gen 16S ARNr y estudio filogenético


El alineamiento de la secuencia obtenida (479 bases) contra la base de datos antes mencionada se corresponde en un 100% con la secuencia del gen 16S ARNr de bacterias del género Herbaspirillum (super-reino: Bacteria; phyla: Proteobacteria; clase: Betaproteobacteria; orden: Burkholderiales; familia: Oxalobacteraceae; género: Herbaspirillum).


Discusión


Los resultados obtenidos mostraron que de los once aislamientos ensayados, solo dos proporcionaron beneficios significativos al crecimiento de plantas de arroz en ensayos en cámara de crecimiento, lo cual también fue reportado para este cultivo por Baldani, et al. (2000) en un estudio de selección de Herbaspirillum spp. Esto estaría indicando que uno de los puntos cruciales para la selección y manejo de diazotróficos es la especificidad planta-bacteria (Salomone y Dobereiner, 1996; Scholoter y Hartmann, 1998). Bhattarai y Hess (1998) concluyeron que el efecto de estimulación del crecimiento por la bacteria en el desarrollo de las raíces en los primeros estadios del crecimiento de la planta puede ser responsable del impacto positivo de la inoculación. Evaluando los dos aislamientos promisorios en invernáculo se verificó este efecto donde se observaron diferencias significativas en la producción de biomasa radicular de los tratamientos inoculados con la cepa 4.2 en presencia y en ausencia de N agregado respecto al T. Esta misma cepa verificó este comportamiento en campo, obteniéndose aumentos significativos del 15% en el rendimiento del cultivo cuando la inoculación estuvo asociada a una fertilización de 100 kg/ha de urea. Bashan y Levanony (1990) y Guimaraes et al. (2003) han reportado aumentos en la producción de granos de arroz del 20% atribuidos a la inoculación con endófitos diazotróficos a nivel de campo. En trabajos anteriores (Ferreira, 2008) se logró suplir parte del requerimiento de N en cultivos de arroz, utilizando un inoculante de Herbaspirillum seropedicae empleando turba como soporte. Es de interés hacer uso del potencial de estos microorganismos endófitos promotores del crecimiento y de las herramientas que aporta la microbiología de suelos para optimizar las propuestas biológicas de sustentabilidad. En base a estos resultados es posible realizar un manejo más eficiente de la fertilización nitrogenada mediante el desarrollo de un inoculante formulado con la cepa 4.2 de Herbaspirillum spp. para las condiciones experimentales utilizadas.


Conclusiones


En conclusión, es interesante destacar que siguiendo la metodología descrita se logró aislar la cepa 4.2 de Herbaspirillum spp. de plantas de arroz de una zona representativa de este cultivo en el Uruguay, y que esta cepa posee potencial para ser utilizada como biofertilizante al aumentar el rendimiento de plantas de arroz en campo de forma significativa.


Agradecimientos


Los autores agradecen a Lage y Cía, S. A. por el financiamiento total de este proyecto realizado en el laboratorio de dicha empresa; a la consultora AS.IN.AGRO. por la instalación y seguimiento de los ensayos de campo, y al Ing. Agr. Martín Lage por su colaboración en este proyecto.


Bibliografía


App A., Santiago T., Daez C., Menguito G., Ventura W., Tirol A., Po J., Watanabe I., De Datta S. K. and Roger P. 1984. Estimation of the Nitrogen Balance for Irrigated Rice and the Contribution of Phototrophic Nitrogen Fixation. Field Crops Research. 9: 17-27.

Baldani V.L.D., Baldani J.I., Lucia V. and Dobereiner, J. 2000. Inoculation of Rice Plants with the Endophytic Diazotrophs Herbaspirillum seropedicae and Burkholderia spp. Biology and Fertility of Soils. 30(5-6): 485-491.

Baldani J. I., Caruso L., Baldani V.L.D, Goi S.R. and Dobereiner J. 1997. Recent Advances in BNF with Non-legume Plants. Soil Biology and Biochemistry. 29(5-6): 911-922.

Baldani J. I., Pot B., Kirchhof G., Falsen E., Baldani V.L.D., Olivares F.L., Hoste B., Kersters K., Hartmann A., Gillis M. and Dobereiner J. 1996. Emended Description of Herbaspirillum : Inclusion of (Pseudomonas) rubrisubalbicans, a Milk Plant Pathogen, as Herbaspirillum rubrisubalbicans comb.nov. : and Classification of a Group of Clinical Isolates (EF group I) as Herbaspirillum species 3. International Journal of Systematic Bacteriology. 46(3): 802-810.

Baldani J. I., Baldani V.L.D., Seldin L. and Dobereiner J. 1986. Characterization of Herbaspirillum seropedicae gen. nov., sp. nov., a Root–associated Nitrogen-fixing Bacterium. International Journal of Systematic Bacteriology. 36: 86-93.

Barraquio W.L., Revilla L. and Ladha J.K. 1997. Isolation of Endophytic Diazotrophic Bacteria from Wetland Rice. Plant and Soil. 194(1-2): 15-24.

Bashan Y. and Levanony H. 1990. Current Status of Azospirillum Inoculation Technology: Azospirillum as a Challenge for Agriculture. Canadian Journal of Microbiology. 36(9):591-603

Bergey´s Manual of Systematic Bacteriology. 2nd. ed., Release 5.0. En: http://dx.doi.org/10.1007/bergeysoutline200310.2005.

Bhattarai T. and Hess, D. 1998. Growth and Yield Responses of a Nepalese Spring Wheat Cultivar to the Inoculation with Nepalese Azospirillum spp. at Various Levels of N Fertilization.Biology and Fertility of Soil, 26(1): 72-77.

Bonilla R., Novo, R., Venegas, N., Glvis, A., Martínez, M., Parra, D. y Venegas, O. 2000. Generación de tecnologías para la utilización de fijación no simbiótica de nitrógeno como alternativa de fertilización. Corpoica-Regional 3. 40 p.

Burris R. H. 1988. 100 Years of Discoveries in Biological N2 Fixation. In: Nitrogen Fixation Hundred Years After. Bothe H., Bruijin F. J. de and Newton W. E. (Eds.) Stuttgard, New York : Gustav Fischer Verlag. pp. 21-3.

Carcaño-Montiel M. G., Ferrera-Cerrato R., Pérez-Moreno J., Molina-Galán J.D. y Bashan Y. 2006. Actividad nitrogenasa, producción de fitohormonas, sideróforos y antibiosis en cepas de Azospirillum y Klebsiella aisladas de maíz y Teocintle. Terra Latinoamericana, 24(4): 493-502.

Dobereiner J., Baldani V.L.D. and Baldani J.I. 1995. Como isolar e identificar bactérias diazotróficas de plantas não-leguminosas. Brasília: EMBRAPA-SPI; Seropédica: EMBRAPA-Cnpab. 60 p.

Elbeltagy A., Nishioka K., Sato T., Suzuki H., Ye B., Hamada T., Isawa T., Mitsui H. and Minamisawa K. 2001. Endophytic Colonization and in Planta Nitrogen Fixation by a Herbaspirillum sp. Isolated from Wild Rice Species. Applied and Environmental Microbiology, 67(11): 5285-5293.

Estrada de Los Santos P., Bustillos-Cristales R. and Caballero-Mellado J. 2001. Burkholderia a Genus Rich in Plant-associated Nitrogen Fixers with Wide Environmental and Geographic Distribution. Applied and Environmental Microbiology, 67(6): 2790-2798.

Ferreira J. 2008. Qualidade de Inoculante, Inoculação e reioculação de Herbaspirillum seropedicae em Duas Variedades de Arroz Irrigado. Tesis doctoral. Rio de Janeiro: Universidad Rural de Rio de Janeiro.

Figueiredo M., Burity H., Stamford N. e Santos C. 2008. Microganismos e Agrobiodiversidade : o novo desafio para a agricultura. Guaíba: Agrolivros. 568 p.

Fuentes L. and Caballero J. 2006. Bacterial Biofertilizers. In: PGPR : Biocontrol and Biofertilization. Liddiqui Z. A. (Ed) Springer : Dordrecht.

Guimaraes D., Baldani, J. e Baldani, V. 2003. Efeito da inoculação de bacterias diazotróficas endofíticas em arroz de Sequeiro. Agronomia, 37 (2): 25-30.

Hoagland D. R. and Arnon D. L. 1950. The Water Culture Method for Growing Plants without Soil. Berkley : Universidade da California. 347 p.

InfoStat. 2008. InfoStat versión 2008. Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina.

Salomone L. and Dobereiner J. 1996. Maize Genotype Effects on the Response to Azospirillum Inoculation. Biology and Fertility, 21(3):193-196.

Scholoter M. and Hartmann A. 1998. Endophytic and Surface Colonization of Wheat Roots by Different Azospirillum brasilense Strains Studied with Strain Specific Monoclonal Antibodies. Symbiosis, 25:159-179.